Telomere
A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos "end" and merοs "part". For vertebrates, the sequence of nucleotides in telomeres is 5′-TTAGGG-3′, with the complementary DNA strand being 3′-AATCCC-5′, with a single-stranded TTAGGG overhang. This sequence of TTAGGG is repeated approximately 2,500 times in humans. In humans, average telomere length declines from about 11 kilobases at birth to fewer than 4 kilobases in old age, with the average rate of decline being greater in men than in women.
During chromosome replication, the enzymes that duplicate DNA cannot continue their duplication all the way to the end of a chromosome, so in each duplication the end of the chromosome is shortened. The telomeres are disposable buffers at the ends of chromosomes which are truncated during cell division; their presence protects the genes before them on the chromosome from being truncated instead. The telomeres themselves are protected by a complex of shelterin proteins, as well as by the RNA that telomeric DNA encodes.
Over time, due to each cell division, the telomere ends become shorter. They are replenished by an enzyme, telomerase reverse transcriptase.
Discovery
In the early 1970s, Russian theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends. Building on this, and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends.In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph G. Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.
In 1983, Barbara McClintock, a distinguished American cytogeneticist and the first woman to receive an unshared Nobel Prize in Physiology or Medicine, received the Nobel Prize for observing that the chromosomes lacking end parts became "sticky" and hypothesized the existence of a special structure at the chromosome tip that would maintain chromosome stability.
Nature and function
Structure, function and evolutionary biology
Telomeres are repetitive nucleotide sequences located at the termini of linear chromosomes of most eukaryotic organisms. For vertebrates, the sequence of nucleotides in telomeres is TTAGGG. Most prokaryotes, having circular chromosomes rather than linear, do not have telomeres. Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. A protein complex known as shelterin serves to protect the ends of telomeres from being recognised as double-strand breaks by inhibiting homologous recombination and non-homologous end joining .In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.
While replicating DNA, the eukaryotic DNA replication enzymes cannot replicate the sequences present at the ends of the chromosomes. Hence, these sequences and the information they carry may get lost. This is the reason telomeres are so important in context of successful cell division: They "cap" the end-sequences and themselves get lost in the process of DNA replication. But the cell has an enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap." In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be reactivated and telomeres reset back to an embryonic state by somatic cell nuclear transfer. The steady shortening of telomeres with each replication in somatic cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.
Telomere length varies greatly between species, from approximately 300 base pairs in yeast to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by telomere-binding proteins. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.
Role in the cell cycle
Telomere shortening in humans can induce replicative senescence, which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. However, shortened telomeres impair immune function that might also increase cancer susceptibility. If telomeres become too short, they have the potential to unfold from their presumed closed structure. The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age, or begin programmed cell self-destruction depending on the cell's genetic background. Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.Shelterin
At the very distal end of the telomere is a 300 base pair single-stranded portion, which forms the T-loop. This loop is analogous to a knot, which stabilizes the telomere, preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by several proteins, the most notable ones being TRF1, TRF2, POT1, RAP1, and TIN2, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1.Shortening
Telomeres shorten in part because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all known DNA polymerases read the template strand in the 3' to 5' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it reads the template strand from 3' to 5'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a short distance ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease, and DNA ligase come along to convert the RNA to DNA and to seal the gaps in between the Okazaki fragments. But, in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it does not happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade any RNA left on the DNA. Thus, a section of the telomere is lost during each cycle of replication at the 5' end of the lagging strand's daughter.
However, test-tube studies have shown that telomeres are highly susceptible to oxidative stress. There is evidence that oxidative stress-mediated DNA damage is an important determinant of telomere shortening. Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem and actual telomere shortening rates, and has a greater absolute impact on telomere length than shortening caused by the end-replication problem. Population-based studies have also indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project, authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E. These results suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.
Telomere shortening is associated with aging, mortality and aging-related diseases. Normal aging is associated with telomere shortening in both humans and mice, and studies on genetically modified animal models suggest causal links between telomere erosion and aging. However, it is not known whether short telomeres are just a sign of cellular age or actually contribute to the aging process themselves.
The age of a father plays a role in the length of a child’s telomeres, which has evolutionary implications. Although leukocyte telomeres shorten with age, sperm telomeres lengthen with age. Shorter telomeres are theorized to impose lower energy costs but also have immune system-related and other aging- and disease-related costs, so the effect of paternal age on telomere length might be an adaptation to increase the chances that the child will be fit for the environment they’re born into.
Potential effect of psychological stress
found that increased perceived psychological stress was associated with a small decrease in telomere length—but that these associations attenuate to no significant association when accounting for publication bias. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic. A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life.Lengthening
The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.It is becoming apparent that reversing shortening of telomeres through temporary activation of telomerase may be a potent means to slow aging. The reason that this would extend human life is because it would extend the Hayflick limit. Three routes have been proposed to reverse telomere shortening: drugs, gene therapy, or metabolic suppression, so-called torpor/hibernation. So far these ideas have not been proven in humans, but it has been demonstrated that telomere shortening is reversed in hibernation and aging is slowed and that hibernation prolongs life-span. It has also been demonstrated that telomere extension has successfully reversed some signs of aging in laboratory mice and the nematode worm species Caenorhabditis elegans. It has been hypothesized that longer telomeres and especially telomerase activation might cause increased cancer. However, longer telomeres might also protect against cancer, because short telomeres are associated with cancer. It has also been suggested that longer telomeres might cause increased energy consumption.
Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.
Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leach's storm-petrel seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. In 2006, Juola et al. reported that in another unrelated, long-lived seabird species, the great frigatebird, telomere length did decrease until at least c. 40 years of age, but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species, telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.
Furthermore, Gomes et al. found, in a study of the comparative biology of mammalian telomeres, that telomere length of different mammalian species correlates inversely, rather than directly, with lifespan, and they concluded that the contribution of telomere length to lifespan remains controversial. Harris et al. found little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities. Gilley and Blackburn tested whether cellular senescence in paramecium is caused by telomere shortening, and found that telomeres were not shortened during senescence.
Sequences
Known, up-to-date telomere nucleotide sequences are listed in website.| Group | Organism | Telomeric repeat |
| Vertebrates | Human, mouse, Xenopus | TTAGGG |
| Filamentous fungi | Neurospora crassa | TTAGGG |
| Slime moulds | Physarum, Didymium | TTAGGG |
| Slime moulds | Dictyostelium | AG |
| Kinetoplastid protozoa | Trypanosoma, Crithidia | TTAGGG |
| Ciliate protozoa | Tetrahymena, Glaucoma | TTGGGG |
| Ciliate protozoa | Paramecium | TTGGG |
| Ciliate protozoa | Oxytricha, Stylonychia, Euplotes | TTTTGGGG |
| Apicomplexan protozoa | Plasmodium | TTAGGG |
| Higher plants | Arabidopsis thaliana | TTTAGGG |
| Higher plants | Cestrum elegans | TTTTTTAGGG |
| Higher plants | Allium | CTCGGTTATGGG |
| Higher plants | Zostera marina | TTAGGG |
| Green algae | Chlamydomonas | TTTTAGGG |
| Insects | Bombyx mori | TTAGG |
| Roundworms | Ascaris lumbricoides | TTAGGC |
| Fission yeasts | Schizosaccharomyces pombe | TTACG |
| Budding yeasts | Saccharomyces cerevisiae | TGTGGGTGTGGTG or GT |
| Budding yeasts | Saccharomyces castellii | TCTGGGTG |
| Budding yeasts | Candida glabrata | GGGGTCTGGGTGCTG |
| Budding yeasts | Candida albicans | GGTGTACGGATGTCTAACTTCTT |
| Budding yeasts | Candida tropicalis | GGTGTAGGATGTCACGATCATT |
| Budding yeasts | Candida maltosa | GGTGTACGGATGCAGACTCGCTT |
| Budding yeasts | Candida guillermondii | GGTGTAC |
| Budding yeasts | Candida pseudotropicalis | GGTGTACGGATTTGATTAGTTATGT |
| Budding yeasts | Kluyveromyces lactis | GGTGTACGGATTTGATTAGGTATGT |
Research on disease risk
Telomeres are critical for maintaining genomic integrity and may be factors for age-related diseases. Laboratory studies show that telomere dysfunction or shortening is commonly acquired due process of cellular aging and tumor development. Short telomeres can lead to genomic instability, chromosome loss and the formation of non-reciprocal translocations; and telomeres in tumor cells and their precursor lesions are significantly shorter than surrounding normal tissue.Observational studies have found shortened telomeres in many types of experimental cancers. In addition, people with cancer have been found to possess shorter leukocyte telomeres than healthy controls. Recent meta-analyses suggest 1.4 to 3.0 fold increased risk of cancer for those with the shortest vs. longest telomeres. However, the increase in risk varies by age, sex, tumor type, and differences in lifestyle factors.
Measurement
Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment southern blot. A Real-Time PCR assay for telomere length involves determining the Telomere-to-Single Copy Gene ratio, which is demonstrated to be proportional to the average telomere length in a cell..Tools have also been developed to estimate the length of telomere from whole genome sequencing experiments. Amongst these are TelSeq, telomerecat and telomereHunter. Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF.
While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned. Nobel Prize winner Elizabeth Blackburn, who was co-founder of one company, promoted the clinical utility of telomere length measures.